Review



2003 addgene 12456 super8xfopflash  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 96
      Buy from Supplier

    Structured Review

    Addgene inc 2003 addgene 12456 super8xfopflash
    2003 Addgene 12456 Super8xfopflash, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 578 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/2003+addgene+12456+super8xfopflash/M50+Super+8x+TOPFlash+(Plasmid+%2312456)/pm40015991-300-240-241
    Average 96 stars, based on 578 article reviews
    2003 addgene 12456 super8xfopflash - by Bioz Stars, 2026-10
    96/100 stars

    Images

    Related Articles

    Software:

    Article Title: Fatty acid uptake activates an AXL-CAV1-β-catenin axis to drive melanoma progression.
    Article Snippet: Continued Reagents and software Source Identifier/reference RRID IGR39 (male) human melanoma cell line Obtained from Luisa Lanfrancone Aubert et al. 1980 CVCL_2076 IGR37 (male) human melanoma cell line Obtained from Luisa Lanfrancone Aubert et al. 1980 CVCL_2075 501mel (female) human melanoma cell line Obtained from Ruth Halaban, Yale Zakut et al. 1993 CVCL_4633 SKmel28 (male) human melanoma cell line ATCC Fogh et al. 1977 CVCL_0526 WM278 (female) human melanoma cell line Obtained from Meenhard Herlyn Herlyn et al. 1985 CVCL_6473 WM115 (female) human melanoma cell line Obtained from Meenhard Herlyn Herlyn et al. 1985 CVCL_0040 WM226.4 (female) human melanoma cell line Obtained from Meenhard Herlyn Herlyn et al. 1985 CVCL_2765 WM793 (male) human melanoma cell line Obtained from Meenhard Herlyn Herlyn et al. 1985 CVCL_8787 CHL-1 (female) human melanoma cell line Obtained from Meenhard Herlyn CVCL_1122 A375M (male) human melanoma cell line ATCC Giard et al. 1973; Fogh et al. 1977 CVCL_B222 3T3-L1 mouse fibroblast cell line ATCC CVCL_B222 Oligonucleotides Human CTNNB1 RT qPCR primers F 5′–3′: GTGCTATCTGTCTGCTCTAGT R 5′–3′: CTTCCTGTTTAGTTGCAGCATC Sigma This study Human 18S RT qPCR primers F 5′–3′: AGTCCCTGCCCTTTGTACACA R 5′–3′: GCCTCACTAAACCATCCAATCG Sigma Aldrich This study siRNA human Caveolin-1 Santa Cruz Biotechnology SC-29241 SMARTpool: On-TargetPlus SRC siRNA Dharmacon, Inc. L-003175-00-0005 siRNA β-catenin r(UCCAUUCUGGUGCCACCAC)d(TT) r(GUGGUGGCACCAGAAUGGA)d(TT) Qiagen This study Negative control siRNA Qiagen 1027281 Human Caveolin-1 subcloning primers F 5′–3′: CGCGGATCCGTGAACC GTCAGATCCGCTAG R 5′–3′: GCTCTAGAGCCTGCAA GTTGATGCGGACATTG Sigma This study Recombinant DNA Super8XTOPFlash Obtained from R. Moon Veeman et al. 2003 Addgene_12456 Super8XFOPflash Obtained from R. Moon Veeman et al. 2003 Addgene_12457 pcDNA3.1-Caveolin-1 WT-Myc-His This study N/A pcDNA3.1-Caveolin-1 Y14F-Myc-His This study N/A Software and algorithms LAS AF Leica SP5 SCR_013673 Glo-Max 96 multidetection system Promega N/A GraphPad Prism GraphPad Software https://www.graphpad.com SCR_002798 ImageLab Bio-Rad ChemiDoc XRS+ System SCR_014210 CXP Becton-Dickinson FACSCalibur SCR_016722 ImageJ N/A https://imagej.nih.gov/ij/ download.html SCR_003070 Continued GENES & DEVELOPMENT 19 extraction buffer before being coated with the primary antibody for 2 h at 4°C in a rotating wheel, followed by two washes with the same buffer to eliminates unbound antibody.Next, extractswere added overnight at 4°C in the rotating wheel.

    Quantitative RT-PCR:

    Article Title: Fatty acid uptake activates an AXL-CAV1-β-catenin axis to drive melanoma progression.
    Article Snippet: Continued Reagents and software Source Identifier/reference RRID IGR39 (male) human melanoma cell line Obtained from Luisa Lanfrancone Aubert et al. 1980 CVCL_2076 IGR37 (male) human melanoma cell line Obtained from Luisa Lanfrancone Aubert et al. 1980 CVCL_2075 501mel (female) human melanoma cell line Obtained from Ruth Halaban, Yale Zakut et al. 1993 CVCL_4633 SKmel28 (male) human melanoma cell line ATCC Fogh et al. 1977 CVCL_0526 WM278 (female) human melanoma cell line Obtained from Meenhard Herlyn Herlyn et al. 1985 CVCL_6473 WM115 (female) human melanoma cell line Obtained from Meenhard Herlyn Herlyn et al. 1985 CVCL_0040 WM226.4 (female) human melanoma cell line Obtained from Meenhard Herlyn Herlyn et al. 1985 CVCL_2765 WM793 (male) human melanoma cell line Obtained from Meenhard Herlyn Herlyn et al. 1985 CVCL_8787 CHL-1 (female) human melanoma cell line Obtained from Meenhard Herlyn CVCL_1122 A375M (male) human melanoma cell line ATCC Giard et al. 1973; Fogh et al. 1977 CVCL_B222 3T3-L1 mouse fibroblast cell line ATCC CVCL_B222 Oligonucleotides Human CTNNB1 RT qPCR primers F 5′–3′: GTGCTATCTGTCTGCTCTAGT R 5′–3′: CTTCCTGTTTAGTTGCAGCATC Sigma This study Human 18S RT qPCR primers F 5′–3′: AGTCCCTGCCCTTTGTACACA R 5′–3′: GCCTCACTAAACCATCCAATCG Sigma Aldrich This study siRNA human Caveolin-1 Santa Cruz Biotechnology SC-29241 SMARTpool: On-TargetPlus SRC siRNA Dharmacon, Inc. L-003175-00-0005 siRNA β-catenin r(UCCAUUCUGGUGCCACCAC)d(TT) r(GUGGUGGCACCAGAAUGGA)d(TT) Qiagen This study Negative control siRNA Qiagen 1027281 Human Caveolin-1 subcloning primers F 5′–3′: CGCGGATCCGTGAACC GTCAGATCCGCTAG R 5′–3′: GCTCTAGAGCCTGCAA GTTGATGCGGACATTG Sigma This study Recombinant DNA Super8XTOPFlash Obtained from R. Moon Veeman et al. 2003 Addgene_12456 Super8XFOPflash Obtained from R. Moon Veeman et al. 2003 Addgene_12457 pcDNA3.1-Caveolin-1 WT-Myc-His This study N/A pcDNA3.1-Caveolin-1 Y14F-Myc-His This study N/A Software and algorithms LAS AF Leica SP5 SCR_013673 Glo-Max 96 multidetection system Promega N/A GraphPad Prism GraphPad Software https://www.graphpad.com SCR_002798 ImageLab Bio-Rad ChemiDoc XRS+ System SCR_014210 CXP Becton-Dickinson FACSCalibur SCR_016722 ImageJ N/A https://imagej.nih.gov/ij/ download.html SCR_003070 Continued GENES & DEVELOPMENT 19 extraction buffer before being coated with the primary antibody for 2 h at 4°C in a rotating wheel, followed by two washes with the same buffer to eliminates unbound antibody.Next, extractswere added overnight at 4°C in the rotating wheel.

    Negative Control:

    Article Title: Fatty acid uptake activates an AXL-CAV1-β-catenin axis to drive melanoma progression.
    Article Snippet: Continued Reagents and software Source Identifier/reference RRID IGR39 (male) human melanoma cell line Obtained from Luisa Lanfrancone Aubert et al. 1980 CVCL_2076 IGR37 (male) human melanoma cell line Obtained from Luisa Lanfrancone Aubert et al. 1980 CVCL_2075 501mel (female) human melanoma cell line Obtained from Ruth Halaban, Yale Zakut et al. 1993 CVCL_4633 SKmel28 (male) human melanoma cell line ATCC Fogh et al. 1977 CVCL_0526 WM278 (female) human melanoma cell line Obtained from Meenhard Herlyn Herlyn et al. 1985 CVCL_6473 WM115 (female) human melanoma cell line Obtained from Meenhard Herlyn Herlyn et al. 1985 CVCL_0040 WM226.4 (female) human melanoma cell line Obtained from Meenhard Herlyn Herlyn et al. 1985 CVCL_2765 WM793 (male) human melanoma cell line Obtained from Meenhard Herlyn Herlyn et al. 1985 CVCL_8787 CHL-1 (female) human melanoma cell line Obtained from Meenhard Herlyn CVCL_1122 A375M (male) human melanoma cell line ATCC Giard et al. 1973; Fogh et al. 1977 CVCL_B222 3T3-L1 mouse fibroblast cell line ATCC CVCL_B222 Oligonucleotides Human CTNNB1 RT qPCR primers F 5′–3′: GTGCTATCTGTCTGCTCTAGT R 5′–3′: CTTCCTGTTTAGTTGCAGCATC Sigma This study Human 18S RT qPCR primers F 5′–3′: AGTCCCTGCCCTTTGTACACA R 5′–3′: GCCTCACTAAACCATCCAATCG Sigma Aldrich This study siRNA human Caveolin-1 Santa Cruz Biotechnology SC-29241 SMARTpool: On-TargetPlus SRC siRNA Dharmacon, Inc. L-003175-00-0005 siRNA β-catenin r(UCCAUUCUGGUGCCACCAC)d(TT) r(GUGGUGGCACCAGAAUGGA)d(TT) Qiagen This study Negative control siRNA Qiagen 1027281 Human Caveolin-1 subcloning primers F 5′–3′: CGCGGATCCGTGAACC GTCAGATCCGCTAG R 5′–3′: GCTCTAGAGCCTGCAA GTTGATGCGGACATTG Sigma This study Recombinant DNA Super8XTOPFlash Obtained from R. Moon Veeman et al. 2003 Addgene_12456 Super8XFOPflash Obtained from R. Moon Veeman et al. 2003 Addgene_12457 pcDNA3.1-Caveolin-1 WT-Myc-His This study N/A pcDNA3.1-Caveolin-1 Y14F-Myc-His This study N/A Software and algorithms LAS AF Leica SP5 SCR_013673 Glo-Max 96 multidetection system Promega N/A GraphPad Prism GraphPad Software https://www.graphpad.com SCR_002798 ImageLab Bio-Rad ChemiDoc XRS+ System SCR_014210 CXP Becton-Dickinson FACSCalibur SCR_016722 ImageJ N/A https://imagej.nih.gov/ij/ download.html SCR_003070 Continued GENES & DEVELOPMENT 19 extraction buffer before being coated with the primary antibody for 2 h at 4°C in a rotating wheel, followed by two washes with the same buffer to eliminates unbound antibody.Next, extractswere added overnight at 4°C in the rotating wheel.

    Subcloning:

    Article Title: Fatty acid uptake activates an AXL-CAV1-β-catenin axis to drive melanoma progression.
    Article Snippet: Continued Reagents and software Source Identifier/reference RRID IGR39 (male) human melanoma cell line Obtained from Luisa Lanfrancone Aubert et al. 1980 CVCL_2076 IGR37 (male) human melanoma cell line Obtained from Luisa Lanfrancone Aubert et al. 1980 CVCL_2075 501mel (female) human melanoma cell line Obtained from Ruth Halaban, Yale Zakut et al. 1993 CVCL_4633 SKmel28 (male) human melanoma cell line ATCC Fogh et al. 1977 CVCL_0526 WM278 (female) human melanoma cell line Obtained from Meenhard Herlyn Herlyn et al. 1985 CVCL_6473 WM115 (female) human melanoma cell line Obtained from Meenhard Herlyn Herlyn et al. 1985 CVCL_0040 WM226.4 (female) human melanoma cell line Obtained from Meenhard Herlyn Herlyn et al. 1985 CVCL_2765 WM793 (male) human melanoma cell line Obtained from Meenhard Herlyn Herlyn et al. 1985 CVCL_8787 CHL-1 (female) human melanoma cell line Obtained from Meenhard Herlyn CVCL_1122 A375M (male) human melanoma cell line ATCC Giard et al. 1973; Fogh et al. 1977 CVCL_B222 3T3-L1 mouse fibroblast cell line ATCC CVCL_B222 Oligonucleotides Human CTNNB1 RT qPCR primers F 5′–3′: GTGCTATCTGTCTGCTCTAGT R 5′–3′: CTTCCTGTTTAGTTGCAGCATC Sigma This study Human 18S RT qPCR primers F 5′–3′: AGTCCCTGCCCTTTGTACACA R 5′–3′: GCCTCACTAAACCATCCAATCG Sigma Aldrich This study siRNA human Caveolin-1 Santa Cruz Biotechnology SC-29241 SMARTpool: On-TargetPlus SRC siRNA Dharmacon, Inc. L-003175-00-0005 siRNA β-catenin r(UCCAUUCUGGUGCCACCAC)d(TT) r(GUGGUGGCACCAGAAUGGA)d(TT) Qiagen This study Negative control siRNA Qiagen 1027281 Human Caveolin-1 subcloning primers F 5′–3′: CGCGGATCCGTGAACC GTCAGATCCGCTAG R 5′–3′: GCTCTAGAGCCTGCAA GTTGATGCGGACATTG Sigma This study Recombinant DNA Super8XTOPFlash Obtained from R. Moon Veeman et al. 2003 Addgene_12456 Super8XFOPflash Obtained from R. Moon Veeman et al. 2003 Addgene_12457 pcDNA3.1-Caveolin-1 WT-Myc-His This study N/A pcDNA3.1-Caveolin-1 Y14F-Myc-His This study N/A Software and algorithms LAS AF Leica SP5 SCR_013673 Glo-Max 96 multidetection system Promega N/A GraphPad Prism GraphPad Software https://www.graphpad.com SCR_002798 ImageLab Bio-Rad ChemiDoc XRS+ System SCR_014210 CXP Becton-Dickinson FACSCalibur SCR_016722 ImageJ N/A https://imagej.nih.gov/ij/ download.html SCR_003070 Continued GENES & DEVELOPMENT 19 extraction buffer before being coated with the primary antibody for 2 h at 4°C in a rotating wheel, followed by two washes with the same buffer to eliminates unbound antibody.Next, extractswere added overnight at 4°C in the rotating wheel.

    Recombinant:

    Article Title: Fatty acid uptake activates an AXL-CAV1-β-catenin axis to drive melanoma progression.
    Article Snippet: Continued Reagents and software Source Identifier/reference RRID IGR39 (male) human melanoma cell line Obtained from Luisa Lanfrancone Aubert et al. 1980 CVCL_2076 IGR37 (male) human melanoma cell line Obtained from Luisa Lanfrancone Aubert et al. 1980 CVCL_2075 501mel (female) human melanoma cell line Obtained from Ruth Halaban, Yale Zakut et al. 1993 CVCL_4633 SKmel28 (male) human melanoma cell line ATCC Fogh et al. 1977 CVCL_0526 WM278 (female) human melanoma cell line Obtained from Meenhard Herlyn Herlyn et al. 1985 CVCL_6473 WM115 (female) human melanoma cell line Obtained from Meenhard Herlyn Herlyn et al. 1985 CVCL_0040 WM226.4 (female) human melanoma cell line Obtained from Meenhard Herlyn Herlyn et al. 1985 CVCL_2765 WM793 (male) human melanoma cell line Obtained from Meenhard Herlyn Herlyn et al. 1985 CVCL_8787 CHL-1 (female) human melanoma cell line Obtained from Meenhard Herlyn CVCL_1122 A375M (male) human melanoma cell line ATCC Giard et al. 1973; Fogh et al. 1977 CVCL_B222 3T3-L1 mouse fibroblast cell line ATCC CVCL_B222 Oligonucleotides Human CTNNB1 RT qPCR primers F 5′–3′: GTGCTATCTGTCTGCTCTAGT R 5′–3′: CTTCCTGTTTAGTTGCAGCATC Sigma This study Human 18S RT qPCR primers F 5′–3′: AGTCCCTGCCCTTTGTACACA R 5′–3′: GCCTCACTAAACCATCCAATCG Sigma Aldrich This study siRNA human Caveolin-1 Santa Cruz Biotechnology SC-29241 SMARTpool: On-TargetPlus SRC siRNA Dharmacon, Inc. L-003175-00-0005 siRNA β-catenin r(UCCAUUCUGGUGCCACCAC)d(TT) r(GUGGUGGCACCAGAAUGGA)d(TT) Qiagen This study Negative control siRNA Qiagen 1027281 Human Caveolin-1 subcloning primers F 5′–3′: CGCGGATCCGTGAACC GTCAGATCCGCTAG R 5′–3′: GCTCTAGAGCCTGCAA GTTGATGCGGACATTG Sigma This study Recombinant DNA Super8XTOPFlash Obtained from R. Moon Veeman et al. 2003 Addgene_12456 Super8XFOPflash Obtained from R. Moon Veeman et al. 2003 Addgene_12457 pcDNA3.1-Caveolin-1 WT-Myc-His This study N/A pcDNA3.1-Caveolin-1 Y14F-Myc-His This study N/A Software and algorithms LAS AF Leica SP5 SCR_013673 Glo-Max 96 multidetection system Promega N/A GraphPad Prism GraphPad Software https://www.graphpad.com SCR_002798 ImageLab Bio-Rad ChemiDoc XRS+ System SCR_014210 CXP Becton-Dickinson FACSCalibur SCR_016722 ImageJ N/A https://imagej.nih.gov/ij/ download.html SCR_003070 Continued GENES & DEVELOPMENT 19 extraction buffer before being coated with the primary antibody for 2 h at 4°C in a rotating wheel, followed by two washes with the same buffer to eliminates unbound antibody.Next, extractswere added overnight at 4°C in the rotating wheel.

    Extraction:

    Article Title: Fatty acid uptake activates an AXL-CAV1-β-catenin axis to drive melanoma progression.
    Article Snippet: Continued Reagents and software Source Identifier/reference RRID IGR39 (male) human melanoma cell line Obtained from Luisa Lanfrancone Aubert et al. 1980 CVCL_2076 IGR37 (male) human melanoma cell line Obtained from Luisa Lanfrancone Aubert et al. 1980 CVCL_2075 501mel (female) human melanoma cell line Obtained from Ruth Halaban, Yale Zakut et al. 1993 CVCL_4633 SKmel28 (male) human melanoma cell line ATCC Fogh et al. 1977 CVCL_0526 WM278 (female) human melanoma cell line Obtained from Meenhard Herlyn Herlyn et al. 1985 CVCL_6473 WM115 (female) human melanoma cell line Obtained from Meenhard Herlyn Herlyn et al. 1985 CVCL_0040 WM226.4 (female) human melanoma cell line Obtained from Meenhard Herlyn Herlyn et al. 1985 CVCL_2765 WM793 (male) human melanoma cell line Obtained from Meenhard Herlyn Herlyn et al. 1985 CVCL_8787 CHL-1 (female) human melanoma cell line Obtained from Meenhard Herlyn CVCL_1122 A375M (male) human melanoma cell line ATCC Giard et al. 1973; Fogh et al. 1977 CVCL_B222 3T3-L1 mouse fibroblast cell line ATCC CVCL_B222 Oligonucleotides Human CTNNB1 RT qPCR primers F 5′–3′: GTGCTATCTGTCTGCTCTAGT R 5′–3′: CTTCCTGTTTAGTTGCAGCATC Sigma This study Human 18S RT qPCR primers F 5′–3′: AGTCCCTGCCCTTTGTACACA R 5′–3′: GCCTCACTAAACCATCCAATCG Sigma Aldrich This study siRNA human Caveolin-1 Santa Cruz Biotechnology SC-29241 SMARTpool: On-TargetPlus SRC siRNA Dharmacon, Inc. L-003175-00-0005 siRNA β-catenin r(UCCAUUCUGGUGCCACCAC)d(TT) r(GUGGUGGCACCAGAAUGGA)d(TT) Qiagen This study Negative control siRNA Qiagen 1027281 Human Caveolin-1 subcloning primers F 5′–3′: CGCGGATCCGTGAACC GTCAGATCCGCTAG R 5′–3′: GCTCTAGAGCCTGCAA GTTGATGCGGACATTG Sigma This study Recombinant DNA Super8XTOPFlash Obtained from R. Moon Veeman et al. 2003 Addgene_12456 Super8XFOPflash Obtained from R. Moon Veeman et al. 2003 Addgene_12457 pcDNA3.1-Caveolin-1 WT-Myc-His This study N/A pcDNA3.1-Caveolin-1 Y14F-Myc-His This study N/A Software and algorithms LAS AF Leica SP5 SCR_013673 Glo-Max 96 multidetection system Promega N/A GraphPad Prism GraphPad Software https://www.graphpad.com SCR_002798 ImageLab Bio-Rad ChemiDoc XRS+ System SCR_014210 CXP Becton-Dickinson FACSCalibur SCR_016722 ImageJ N/A https://imagej.nih.gov/ij/ download.html SCR_003070 Continued GENES & DEVELOPMENT 19 extraction buffer before being coated with the primary antibody for 2 h at 4°C in a rotating wheel, followed by two washes with the same buffer to eliminates unbound antibody.Next, extractswere added overnight at 4°C in the rotating wheel.



    Similar Products

    2003 addgene 12456 super8xfopflash  (Addgene inc)
    96
    Addgene inc 2003 addgene 12456 super8xfopflash
    2003 Addgene 12456 Super8xfopflash, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/2003+addgene+12456+super8xfopflash/M50+Super+8x+TOPFlash+(Plasmid+%2312456)/pm40015991-300-240-241
    Average 96 stars, based on 1 article reviews
    2003 addgene 12456 super8xfopflash - by Bioz Stars, 2026-10
    96/100 stars
    		  Buy from Supplier

    Image Search Results